HUMAN VARIATION AND RACE

1) High levels of solar radiation negatively impact our survival and disturb homeostasis because overexposure is so possible and so common. We as humans benefit by sin exposure, but it is easy to get too much sun and do extensive skin damage, in a number of cases irreversible.

2) Short term adaptation: One example would be human beings wearing sunglasses to protect their eyes, or sunscreen to protect their skin, limiting exposure.
Facultative adaptation: An example here would be changes in skin tone as a result of prolonged exposure. I am specifically referring to getting tanned or sunburned as a result of exposure. Developmental Adaptations: In humans, prolonged exposure could result in chromosomal changes. Melanin levels are increased over time as a result. Cultural Adaptation: One example here could be humans choosing to cover their bodies when they are aware that prolonged exposure could be harmful to them.

3) Studying human variation in this way can help with understanding people from different cultures. It is always easier to accept people from different walk of life if we know how it is they came to be the way they are. For instance, if we were to meet someone with skin color different then ours we might assume we know certain things about them. They may appear to be from one culture or race and that may not be the case at all. For example, we may meet someone from Africa who dresses in heavy clothing from head to toe in the hot sun, and think that appears crazy. When in reality they are attempting to protect themselves from harmful exposure. If we did not try to get that information we might assume all sorts of crazy things that have no basis in reality, but are culturally a necessity for that individual.

4) In regard to race as it relates to high levels of solar radiation, according to skincancer.org the annual incidence rate of melanoma is 1 per 100,000 in blacks, 4 per 100,000 in Hispanics, and 25 per 100,000 in non-Hispanic whites. We could take this to mean that African Americans have made an genetic adaptation to all of the exposure, and do not get skin cancer as easily. That is just one interpretation. However, the numbers are not so skewed to suggest this is the case across the board. Environmental impact on cultures is more reliable than race as an explanation for these changes because the environment you live in plays a much bigger part in who you are-even if on the surface racial stereotypes appear to fit. More often than not it is the environment causing the behavior, not because an individual is part of a particular race and therefore programmed a particular way. 
5)

                                                           LANGUAGE EXERCISE


So-I am actually going to start with the second exercise first, simply because I found it so interesting. This exercise-which required me to communicate verbally but in no other way-was EXTREMELY challenging. I completely underestimated the degree to which I communicate nonverbally. Also, my family had a great time with this little exercise because they were well aware that I had toi limit my communication.

One thing I noticed was how emotionless I became. In an effort not to break the rules I found myself much more straightforward in the way I spoke. Evidently, my version of sarcasm requires a lot of nonverbal cues. My family loved it-my son kept busting me with every eye roll, every raising of my eyebrows. It was actually a lot of fun.

With raged to communicating nonverbally, this was tough also. Even though-as I previously mentioned-I communicate a lot nonverbally, without the verbal component my ideas needed to VERY simple. I could only convey the most mundane things-I'm thinking, or I'm hungry, etc. My family also had fun with this as you can well imagine.

As for who controlled the conversation, that was not a huge factor when I was able to communicate verbally. It was all straightforward, but I found it fairly easy to carry on the conversation. However, when it came to going completely nonverbal my participation was minimal. I was not able to control the conversation at all, but I could participate minimally. After awhile my family and I just had fun with it. They were making fun of me for all the hand gesturing and pointing-it was one big crazy game of charades and it was so much fun!

The last question regarding the two cultures is s simple one for me. I think the nonverbal group would have a difficult time expressing complex ideas without the ability to verbalize. I also believe the verbal group would look down on the nonverbal group, or at very least there is the huge potential for the nonverbal group to be misunderstood. This is most certainly a metaphor for the some of the situations that exist in the world today. There are cultures in the world that choose to shun a lot of the conventions that Americans find important-such as social media-and because those cultures choose a more simple existence there are some in our culture that look down on those cultures. Sometimes it takes a considerable amount of effort to understand someone, but in the end it's usually worth it. In the end, that is certainly a more positive choice than the choice to hate in a knee-jerk fashion what we do not understand.

                                                        THE PILTDOWN HOAX

The "Piltdown Hoax" refers to a fossil discovered in Piltdown, England in the early 1900's. A strange piece of skull was discovered by a laborer digging in Barkham Manor near the village of Piltdown. He passed his discovery on to an amateur archaeologist named Charles Dawson, who then set about digging in the same area to try and find more fossils of what he believed to be the first early man discovered in Great Britain. This was very important in Great Britain at the time, because most of the surrounding countries had found remnants of early man, but the British to that point had come up empty.
In December 1912, Dawson along with Sir Arthur Smith Woodward presented their findings and claimed that the earliest man had lived right there in England. Shortly after a second sight unearthed more remains from what was believed to be "Piltdown Man", and the scientific community in Britain was ecstatic. However, in 1953 the news comes out that the entire Piltdown Man theory is a hoax. the fossils were put through a chemical test and determined to be much younger than Dawson and his team had claimed them to be.
As far as significance, Dawson and his team believed this to be the "missing link", however we know this term to be incorrect. Instead, this find would been another example of how closely related humans and our ape ancestors are. This is the case because the find itself was an ape-like jawbone with human-like teeth.
As far as the scientists and the faulty data, I think emotion played too big a role in validating the findings. The circumstances being what they were at the time, Dawson had to have felt a lot of pressure to deliver something that was a major discovery for Great Britain. It isn't hard to imagine the findings being hurried along and fudged scientifically in the name of Great Britain and Dawson himself.
The events that proved the Piltdown Man fossils to be a hoax began over 40 years after the discovery. In an effort to authenticate and date the fossils, a representative from the museum they were being kept in performed a chemical test. What it proved above all else was that the skull was far less old than  was initially proposed(it had also been stained a different color), which proved Piltdown Man could not be who they had claimed him to be. Upon microscopic examination, they also determined that the teeth had been filed down. This was done to make it appear to be human when in fact it was not. The jaw that was found was also not human-it was very likely from an ape.
With regard to a specific test, it was a fluorine absorption test that disproved the stated age of the skull. This would test the level of fluoride found in bone, which it would have soaked in from the groundwater in soil it was preserved in-which in turn would prove its' age.
I suppose it is possible to remove the human factor from science, but it would be a catastrophic move in my opinion. Scientists are the ones that form their hypothesis based on tests they conduct, and sometimes it is a hunch that provides the spark for these tests. No machine would ever have the hunch or intuition of the great scientific minds we have all been fortunate enough to benefit from.
With regard to the life lesson that can be learned, it always critical to have a healthy dose of skepticism when findings have not been properly tested or verified by the right sources. Science does not root for any particular findings, it just tells us the truth if we test correctly and are willing to accept what we discover.

                                    COMPARATIVE PRIMATES: DENTITION PATTERNS

Primate #1: Sifaka  

The Sifaka lives in dry deciduous forests as well as spiny forests, where it feasts on a herbivoric diet of flowers, fruits, buds, tree bark and more. It is on the endangered list for two reasons: the first is their forest habitats are being destroyed, and second they are hunted in some regions for their meat. With regard to their dentition patterns, the Sifaka is unique. Their pattern is 2 incisors, 1 canine, 3 premolars and 3 premolars. Their upper incisors are very small and slightly angled. In the mandible, it displays what is referred to as the "toothcomb"-which is 6 teeth in a row together, much like a comb. It also has high, shearing molar crests, which helps the Sifaka to shred the leaves, flowers, and fruit that it eats.

Primate #2: The Spider Monkey

Spider Monkeys are found in tropical forests, from southern Mexico to Brazil. They stick primarily to the upper layers of the rainforest, foraging in the high canopy. Their diet consists mainly of fruits, but they also eat flowers, leaves and occasionally insects. Like the Sifaka, they are also facing significant habitat destruction, but are far more in demand for their meat, mainly due to their large size. They are listed, depending on which species, everywhere from vulnerable to critically endangered. With regard to the dentition, their pattern is 2 incisors, 1 canine, 3 premolars,  and 3 more premolars.  Spider monkeys use their incisors to eat the fruit they love so much.

Primate #3: The Olive Baboon

The Olive Baboon is found in 25 countries throughout Africa. It can thrive in a number of different habitats, from grasslands, to rainforests and deserts. It is considered an endangered species. One major difference with the baboon vs. the previous 2 animals would be the fact that it is omniverous. It will eat everything from a large variety of plants, to small invertebrates and mammals, to some birds as well. It's dentition pattern is 2 incisors, i canine, 2 premolars and 3 premolars. This slight difference in its' dentition pattern allows the baboon to be the omnivore it is.

Primate #4: The Lar Gibbon

The Lar Gibbon is found almost exclusively in rainforests, but they also inhabit dipterocarp and bamboo forests as well. It is considered frugiverous, which means that fruit makes up over 50% of its' diet. It also eats leaves, insects and some flowers. The Lar gibbon is also on the endangered list. Like the Olive Baboon, the Lar Gibbon's dentition pattern is also 2 incisors, 1 canine, 2 premolars, and 3 premolars. Though its' dentition pattern might indicate that the gibbon has adapted to a diet similar to the baboon, that is not the case. As I mentioned it is primarily a fruit eater.

Primate #5: The Chimpanzee

Chimpanzees, or "Chimps" for short, in the wild live mainly in the grasslands and rainforests of Africa. They are on the endangered list due to hunting, habitat destruction, as well as disease. with regard to their dentition pattern, it is the same as the baboon and gibbon-2 incisors, 1 canine, 2 premolars and 3 premolars. Much like the baboon, the chimp has a variety of dietary choices, from small animals to plants to fruits.

Conclusion: With regard to the dentition patterns of all 5 primates, the conclusion I came to is the baboon and chimpanzee have a pattern that allows them to chew and consume a wider variety of foods. The Sifaka and Spider Monkey's patterns indicate that they are herbivores, consuming a diet of mainly leaves, flowers and some fruit. 

ANALOGOUS/HOMOLOGOUS

                                                        ANALOGOUS/HOMOLOGOUS
HOMOLOGOUS

1)  The two different species I chose as having homologous traits are human beings and birds.

2) The homologous trait they share is the forelimb. Though humans are covered in skin and birds in feathers, their forelimbs have the same bone structure. These would include the humerus, ulna, radius, carpals, metacarpals, and phalanges. However, modifications have been made to each species to suit their specific functions. Humans y=use their forearms to reach and pick up objects, while birds forelimbs have evolved to help them fly. The reason they differ is humans lived on land and birds lived in trees which gave them the need to fly.

3) The common ancestor of the two species is thought to be Archaeothyris.

file:///Users/Guest/Documents/human%20and%20bird%20structure.jpg

ANALOGOUS

1) The two different species I chose with analogous traits are bats and birds.

2) The trait they share is their wings. Even though they both have wings for flying, their wings have evolved over time independent of each other, with no common ancestor.

3) Going back far enough in time, the common ancestor birds and bats shared were terrestrial quadrupeds. However, the bats flight happens because of a structure that consists of a membrane stretched across four extremely elongated fingers, while a bird's structure is made of feathers, which are strongly attached to the forearm (the ulna) and the highly fused bones of the wrist and hand, with only tiny remnants of two fingers remaining, each anchoring a single feather.

Protein Synthesis DNA Strand

Here is my DNA Strand:

TACACTGATCGGAAGCATAATTTAGGGTCCATC

Good luck!

Charles Darwin's Influences

As I researched the short list of great thinkers and scientists included with this assignment, the thought occurred to me that all of them brought something significant to the table as it pertains to evolution. For example, though Lamarck's theories have largely been discredited-such as extinction does not exist, and instead animals just die and become different species-Lamarck does deserve credit for initiating the idea that traits were inherited. Cuvier came along and proved that extinctions were in fact a reality, but his theories on evolution beyond that were still laced with creationist ideas that did not hold up scientifically. Though these men had some influence, they were not enough to completely change the framework of how the scientific community looked at the concept of evolution.

That distinction, in my opinion, belongs to Alfred Russel Wallace. I chose Wallace because his work so closely resembled Darwin's-right down to him even using similar terminology to describe the support of his theories. Wallace went on many ship explorations, and developed the theory of Natural Selection-calling Sarawak Law, a reference to a part of Borneo he spent significant time on during the wet season. He thought of the idea as a "branching tree", where new species come from old species much like new twigs grow from older branches. My source was PBS.org, and it a link is listed here: http://www.pbs.org/wgbh/nova/evolution/great-minds-think-alike.html

The bullet point that Wallace addresses is the following:
" If the environment changes, the traits that are helpful or adaptive to that environment will be different. Organisms with those new adaptive traits will have greater reproductive success than others and those new beneficial traits will spread, producing a change in the population. This is the process of natural selection, essentially the process of the natural environment selecting the organisms that will be most successful."

Wallace strongly supports this theory with the idea that identical species could and in fact did exist in completely different climates-and the contrary, that animals existed in one place with the same climate as the country near it where none of those animals were-suggesting that the idea of what he referred to as "special creation"-and what we now refer to as Intelligent Design-was unsupported. Otherwise animals in similar climates only 20 miles or so from each other would be the same, and not completely different.

It is questionable as to whether or not Darwin's theory would have come to light without Wallace. The reason being that Wallace at a certain point began corresponding with Darwin, and shared this theory with him. Now, because Darwin had come up with virtually the exact same information, it is possible-maybe even likely-that he would have developed it without Wallace. After all, Wallace sent his theory to Darwin after Darwin had written the chapter in his book that addressed Natural Selection. However, Darwin had been more concerned about publishing his work, a fear Wallace did not share. Wallace had in fact already had his theories published in magazines, to very little fanfare or regard. So essentially the two men supported each other's theories simultaneously, without even realizing it. I think a man like Wallace at the very least completely legitimizes Darwin's claims and makes it far easier for the many doubters of that era to accept this new information.

With regard to Darwin publishing his book The Origin of Species, for many reasons-political and otherwise-any notion that strayed from the church's ideas about man and his/her evolution was greeted with scorn and ridicule. Lamarck, for example, was vilified in most scientific circles(he was also French, and this was post-revolution so the French were very unpopular). So needless to say Darwin was very hesitant to share his findings with a country whose leaders were more than happy to marry church and state. This is why I think Wallace is so important, because his findings gave Darwin the confidence and motivation he needed to publish his now famous book.